Oligonucleotides: RNA¶
Nucleic Acid Sequences¶
OpenMS also supports the representation of RNA oligonucleotides using the
NASequence class:
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 | from pyopenms import *
oligo = NASequence.fromString("AAUGCAAUGG")
prefix = oligo.getPrefix(4)
suffix = oligo.getSuffix(4)
print(oligo)
print(prefix)
print(suffix)
print()
print("Oligo length", oligo.size())
print("Total precursor mass", oligo.getMonoWeight())
print("y1+ ion mass of", str(prefix), ":", prefix.getMonoWeight(NASequence.NASFragmentType.YIon, 1))
print()
seq_formula = oligo.getFormula()
print("RNA Oligo", oligo, "has molecular formula", seq_formula)
print("="*35)
print()
isotopes = seq_formula.getIsotopeDistribution( CoarseIsotopePatternGenerator(6) )
for iso in isotopes.getContainer():
print ("Isotope", iso.getMZ(), ":", iso.getIntensity())
|
Which will output
AAUGCAAUGG
AAUG
AUGG
Oligo length 10
Total precursor mass 3206.4885302061
y1+ ion mass of AAUG : 1248.2298440331
RNA Oligo AAUGCAAUGG has molecular formula C97H119N42O66P9
===================================
Isotope 3206.4885302061 : 0.25567981600761414
Isotope 3207.4918850439003 : 0.31783154606819153
Isotope 3208.4952398817004 : 0.23069815337657928
Isotope 3209.4985947195 : 0.12306403368711472
Isotope 3210.5019495573 : 0.053163252770900726
Isotope 3211.5053043951 : 0.01956319250166416
The NASequence object also allows iterations directly in Python:
1 2 3 4 5 | from pyopenms import *
oligo = NASequence.fromString("AAUGCAAUGG")
print("The oligonucleotide", str(oligo), "consists of the following nucleotides:")
for ribo in oligo:
print(ribo.getName())
|
Fragment ions¶
Similarly to before for amino acid sequences, we can also generate internal fragment ions:
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 | from pyopenms import *
oligo = NASequence.fromString("AAUGCAAUGG")
suffix = oligo.getSuffix(4)
oligo.size()
oligo.getMonoWeight()
charge = 2
mass = suffix.getMonoWeight(NASequence.NASFragmentType.WIon, charge)
w4_formula = suffix.getFormula(NASequence.NASFragmentType.WIon, charge)
mz = mass / charge
print("="*35)
print("RNA Oligo w4++ ion", suffix, "has mz", mz)
print("RNA Oligo w4++ ion", suffix, "has molecular formula", w4_formula)
|
Modified oligonucleotides¶
Modified nucleotides can also represented by the Ribonucleotide class and
are specified using a unique string identifier present in the
RibonucleotideDB in square brackets. For example, [m1A] represents
1-methyladenosine. We can create a NASequence object by parsing a modified
sequence as follows:
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 | from pyopenms import *
oligo_mod = NASequence.fromString("A[m1A][Gm]A")
seq_formula = oligo_mod.getFormula()
print("RNA Oligo", oligo_mod, "has molecular formula",
seq_formula, "and length", oligo_mod.size())
print("="*35)
oligo_list = [oligo_mod[i].getOrigin() for i in range(oligo_mod.size())]
print("RNA Oligo", oligo_mod.toString(), "has unmodified sequence", "".join(oligo_list))
r = oligo_mod[1]
r.getName()
r.getHTMLCode()
r.getOrigin()
for i in range(oligo_mod.size()):
print (oligo_mod[i].isModified())
|
DNA, RNA and Protein¶
We can also work with DNA and RNA sequences in combination with the BioPython
library (you can install BioPython with pip install biopython):
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 | from pyopenms import *
from Bio.Seq import Seq
from Bio.Alphabet import IUPAC
bsa = FASTAEntry()
bsa.sequence = 'ATGAAGTGGGTGACTTTTATTTCTCTTCTCCTTCTCTTCAGCTCTGCTTATTCCAGGGGTGTGTTTCGT'
bsa.description = "BSA Bovine Albumin (partial sequence)"
bsa.identifier = "BSA"
entries = [bsa]
f = FASTAFile()
f.store("example_dna.fasta", entries)
coding_dna = Seq(bsa.sequence, IUPAC.unambiguous_dna)
coding_rna = coding_dna.transcribe()
protein_seq = coding_rna.translate()
oligo = NASequence.fromString(str(coding_rna))
aaseq = AASequence.fromString(str(protein_seq))
print("The RNA sequence", str(oligo), "has mass", oligo.getMonoWeight(), "and \n"
"translates to the protein sequence", str(aaseq), "which has mass", aaseq.getMonoWeight() )
|